Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_178D7-3
Clone ID CMHD-GT_178D7-3
Vector Gep-SD5
Project cmhd

Sequence tag CMHD-GT_178D7-3
Sequence
ATCAGTTCATGTGTGGAGAAACAGTCCCAGCACCTTCAACCAACAAGGAGTTAGTTAAATGCTGAAGAGGCTCTCAGGTA
CCCACATCCTGAACCGTGGGGGCTGAGCCCAGGTGGATGGATCCAGTGCAGAGTTACCAACCTCCTCGATGGGCAGCCTC
AGGGGTGTGATCTTCATCAGCCACTGAACTCAGCATGAAAAAGGGAGCCTATGACATGCCAGCCCTGGATTCCATACTGG
GACTGGAAGGATTCCTAATTGTCCGTCTGAATTTAAGGAAGAGCCTTATTATAAACTGTGGTTTTTCCTTCAGTCGGCTG
CATCATTTGAACATCT
Sequence Type mRNA
Unitrap ID UNI13971

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 32896096..32896431 336
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021905 (Dph3) NM_001047433 DPH3 homolog (KTI11, S. cerevisiae) Gene [Source:MGI (curated);Acc:Dph3-001]

 
Come back to gene ENSMUSG00000021905


For any suggestions or comments, please send an email to unitrap@crg.es