Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10007G2
Clone ID IST10007G2
Vector VICTR75
Project tigm

Sequence tag IST10007G2BBR1
Sequence
TACCCATAGTGAGAGATCCAGGTCAATCTGGATTATAAAGCTAGAATGAGAAAAAGGGGAAAAAAAGCATTAAAGATGGA
CCAGTGGTACTGAAGCGGGTCCCAAATGGCAGAGTTCACTTCTGGTGTTCATACAGTTGGCAGAGTAATTGCTCATTAAT
GTCTGGTAAATGAAAATGGTAAACAATTATGAATCATAACTAACAATGGGTTCAGAGCTCTGCAGGTTGTTGTTGTTTTA
TTTTTGTTTGTTCTTTGTTTTATAAGATAGGATTTCTCTGTAGCCCTGGCTGTCCTGGAACTTGCTCTGTATCTCAGGCT
GGCCTTAAACTCACAGATCC
Sequence Type genomic DNA
Unitrap ID UNI563

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 77912377..77912711 325
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037750 (BC017647) NM_145430 Uncharacterized protein C17orf63 homolog [Source:UniProtKB/Swiss-Prot;Acc:Q6P539]

 
Come back to gene ENSMUSG00000037750


For any suggestions or comments, please send an email to unitrap@crg.es