Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11247E10
Clone ID IST11247E10
Vector VICTR76
Project tigm

Sequence tag IST11247E10HMF1
Sequence
ATCCAGGAGGCCTAACCCTATGTAAAAAGGCAGTTTANGGTTCANACACAGCCAGCAATCANCCCCGANGTTANCACTGG
TAGAATTAAGGAGAGAATAGGTANCCGGTGCCATGTGAAGGAGATGAGTTAGATCTAATGTGTTGGCTTGGCTTGGAGAA
NCANCACTGCTTGTCATTGGAACCAGTTGCATGTAAGGGACAGGAGCTTTGACCTGGGAGCAATGTCATCCCATGGTCAA
CG
Sequence Type genomic DNA
Unitrap ID UNI14271

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 106587821..106588061 225
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020717 (Pecam1) NM_008816 platelet/endothelial cell adhesion molecule 1 Gene [Source:MGI (curated);Acc:Pecam1-002]


Sequence tag IST11247E10BBF1
Sequence
ATCCAGGAGGCCTAACCCTATGTAAAAAGGCAGTTTAGGGTTCAGACACNGCCAGCAATCAGCCCCGAGGTTAGCACTGG
TAGAATTAAGGAGAGAATAGGTAGCCGGTGCCATGTGAAGGAGATGAGTTAGATCTG
Sequence Type genomic DNA
Unitrap ID UNI14271

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 106587926..106588061 134
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020717 (Pecam1) NM_008816 platelet/endothelial cell adhesion molecule 1 Gene [Source:MGI (curated);Acc:Pecam1-002]

 
Come back to gene ENSMUSG00000020717


For any suggestions or comments, please send an email to unitrap@crg.es