Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14651F4
Clone ID IST14651F4
Vector VICTR74
Project tigm

Sequence tag IST14651F4BBF1
Sequence
CTTCCACCACGTGGGCTCCAGGTTTTAAACTTGAATTGTCAGGCTTGGCTGCAAACACTTACACCCACTGAGCACCAGCT
CGCCAACCTAAAGGCTGTAATATTTATTTTCCAGCTCTGTCCCTGGGTAGGGATTGCTCTGAAGAAAGCACTAATGGTAC
TTCCACTTCCGGTTCGCTCTGCTTCCACTCAGAGGAAAGGCCTAGAGAAGCCGGAAGATCCAGGCACATCGGTGGGATGC
TGACAGTGTGTGGGGACTGCCCACCCTTTCCACGAGTGAGTGCAAAAGTGCGCCCATGGGATGTGGTGGGAGGGTACNAG
CTGGTGTGCTGCNNAAGGTTCTAAAAAATCTCCCACACAGGGGACAGGTGTGGGCCTNANGGGAATANGAAGCTANANGC
AACCTNNNTGCCCATCNNTGGGCNANTGNNTAANTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 29268006..29268438 399
NO GENE  


Sequence tag IST14651F4HMF2
Sequence
GTGCTGGGATTGAAGATGTGTCCCACACCGCCCAGTTTGTTGTCAGGAGTGCTGAGATTAAATCCTGTTCCATCATGACC
ACCACCATGACCAGCTGTGGCTACATGTTAAAAGATAATAAGTTGAAGAGGACTCAGAGGGTAAGAACCTTTGCTGCTCT
TGCAGACAGGGCCCCAGTTTGATTCCTAGTTCCCACACAGTAGTGCACAATCAGGAGCTGACACCCTCTCCGACCTCTGT
GGTCACCAGACATGCAGGGGATACACATACACACCTGCAAGCAACATACTCATACCCATTAAAAAGTAAAAACATAGCCG
GGCCGGGTGTTGGTGGCNCATGCCTTTAATCCCAGCACTCANGANGCAGANGCAGGTGGATTTCTGAGTTTGAGGCCNGC
CTGGTCNACAGAGTGAGTACCANGANAGCCAGGGCTACNCAGANAAATCCTGTCTCGAAAANNCAAAAAACN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 106579855..106580325 447
 
EST/CDNA Est Name
  BY726363.1 - CF165785.1 - CF164416.1 - CN680180.1 - BB630762.1


Sequence tag IST14651F4HMR1
Sequence
TTCACTGTAGGCAGAGGTAGGCAGAGGATCTATGAATTTGAGGCCAGCCAAGTCTACAGAGTGAGTTCCAGGACAGCTAG
AGCTACTCAGAGAAACCCTGTCTAAAACAAAACAAAACAAAAACAAAAAACTGGGGCTGGAGAGGTGACTCAGACTCTTG
ACTGTTCTTCCAGAGGTCCTGAGTTCAATTCCCAGTAACCACATGGTGGCTCACAACCATCTGAAATGGGATCTGATGCC
CTCTTCTAGATAGAGTGTCTGAAGAGAGCGACAGTATACTCATATACATAAAATAAATAAATCTTAAAAACAAACAANCN
AAATGAAAGAAGAGGAGGAAACAAAAAGAGAGANGGAAGAAAAGAAGGAAGGGCTCTTTACCAGCTCTTNNNACNNNTCA
GAGCANGGATGGTTTTCTAGCTGGAAACCNTCNCTTTGTGGCTCTTACAGTGAGGCNAGAGACTANTCCTCANCTGCNAT
GTGNCN
Sequence Type genomic DNA
Unitrap ID UNI14271

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 106579377..106579857 449
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020717 (Pecam1) NM_008816 platelet/endothelial cell adhesion molecule 1 Gene [Source:MGI (curated);Acc:Pecam1-002]

 
Come back to gene ENSMUSG00000020717


For any suggestions or comments, please send an email to unitrap@crg.es