Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14396D9
Clone ID IST14396D9
Vector VICTR74
Project tigm

Sequence tag IST14396D9HMR1
Sequence
AATTGTAAAGTGTCTTTTGTTCGCCTGTGCCTCCCTCTGCTGACCTANGCTTNTCCTGGAAGCCTCTAGCCTCTGTACAA
TCGAATCCAGGCCTANAATGTTCTCAGCCTCTGANACTTACTGCTCACTCTTTCTAGTTCTTTCTGAACTCTGGCTGACT
GGTTCAACTCAGCTCCTCTCCANACTGACTGATTCAGTCTGGCTTCTTTTTCTGCCN
Sequence Type genomic DNA
Unitrap ID UNI33975

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 70176297..70176513 203
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022074 (Tnfrsf10b) NM_020275 tumor necrosis factor receptor superfamily, member 10b Gene [Source:MGI Symbol;Acc:MGI:1341090]


Sequence tag IST14396D9HMF2
Sequence
NNNNNNNNNNGCNNTNNNNCNNANNGANCANCNNANGCACACNNGGGAATGGGGAGCGCCACCACCANCTCANAANCAGG
CACCTANGAGACAAACCTGGAACGCTCCAGGAGCACCTCGACGCTTACAAGAAACAGCGCGTGCACACACCANACGGGAA
GGGTATGCAACGCCACCGGCCACATCCACCGACTCTGGGAACATGGTCAAGCGAGACACGACCAAAGTGAAACACGTGAG
GGCACAACCGGGCGCCTCACACATCCNCAANGACCACNCGAACCACTGANAAAAGTGCGCGCGGGGCAGCGCTCGGGCCG
GANANCCNCACCNNTGCCTTCCACACACCACCGGCANANGGATGGGGTGNAGAGACNAGGGGCCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14396D9BBF1
Sequence
GTCAGAGTCTGGATTTTTGCTGTTTGGGGGGAAGTGGGAGATGGAATGTGAATCACAGGAACAAGACAGATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 70176190..70176262 73
NO GENE  

 
Come back to gene ENSMUSG00000022074


For any suggestions or comments, please send an email to unitrap@crg.es