Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14464A5
Clone ID IST14464A5
Vector VICTR74
Project tigm

Sequence tag IST14464A5HMR1
Sequence
AGGAACTTAACTAAAATGAGTTCTAGGTTAGTTTACTATTGAAATGTGAAGTACAAGTGGTACTAGGAAAAAGGAAAAGC
ACGTGTTC
Sequence Type genomic DNA
Unitrap ID UNI7354

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 103242018..103242104 87
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033792 (Atp7a) NM_009726 ATPase, Cu++ transporting, beta polypeptide Gene [Source:MGI (curated);Acc:Atp7a-002]


Sequence tag IST14464A5HMF1
Sequence
TTCCTAACATAGGAAACTCTCCCGTCTCACATGAATTGTTTATCCCAAAACCATTTGCTAAGGGAGCTAGCTGTTTCTCC
CTGAAATGCTTTCACTATTACATATATGCTAAAATCTTATTTAGAGTGATGCCCTCTTTGCTTGTTTGAACAGATGGCTC
AGTGATTAAGAACACATAATGGCTTTCCTGTAGACCAGGGTTTAATTCCCAGCATCCACATCANATGGCTCTAAGTAGCC
TATAACTCTAGTTCCAAAGTATCTGGTCCAAAAGAAACCAAGGACAAATAACTATCTCTGGTACTTACTAGCAAACCAAA
GTACAAGCTGGCCTCCAGGCTCTCTTANCATCACACAGAACTGTTACAGANTCTATGGCTGGCATCCTGTATCTTCTTGC
NNCGTCACCNANCCTAAACTCCTCCAGCTCCATGGGCTCTCTTGGTGCTCTCTTTTCTTCCTNNCNCNCCNTTCTCNCAC
CCNCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 103241541..103242022 456
NO GENE  

 
Come back to gene ENSMUSG00000033792


For any suggestions or comments, please send an email to unitrap@crg.es