Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11089C10
Clone ID IST11089C10
Vector VICTR76
Project tigm

Sequence tag IST11089C10HMF1
Sequence
TTGTCTGCTTAGAAGAGCTGTAAGCCATATCTTTCCCACAATTCTACTTAGCCCGGANCCCATCAGGTAAAAAGGTTCAA
GAGCACCTGAGTAGGTGCAGGGGGTACAGGCCTGAAATCCAACACCTGGGAGATGATGGGAGAAAGTCCCTTTCTTAAGA
AAAACAAAACAAAAACACACACATCCAAGATGGGGTGCAACTTGCCTAGTGATGTATTTATTTGCCTAGTGTGTTGGAAT
CCCTGGATTCCACCCCACCCCCACCCCCAGTATCATAAACCAACTACAGAACACTGGGTGTGTCTTTTCTTTTTCGAGAT
GCTGGGATGGGATCCAGGCTTGGGTCTGAACTGGGCAAATGCTCTCCACTAGCCTTTGGGGTGCCTTCCTAATTATCTTG
TTA
Sequence Type genomic DNA
Unitrap ID UNI13754

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 77699088..77699488 399
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000017453 (Pipox) NM_008952 pipecolic acid oxidase Gene [Source:MGI (curated);Acc:Pipox-001]


Sequence tag IST11089C10BBF1
Sequence
TTGTCTGCTTAGAAGAGCTGTAAGCCATATCTTTCCCACAATTCTACTTAGCCCGGAGCCCATCAGGTAAAAAGGTTCAA
GAGCACCTGAGTAGGTGCAGGGGGTACAGGCCTGAAATCCAACACCTGGGAGATGATGGGAGAAAGTCCCTTTCTTAAGA
AAAACAAAACAAAAACACACACATCCAAGATGGGGTGCAACTTGCCTAGTGATGTATTTATTTGCCTAGTGTGTTGGAAT
CCCTGGATTCCACCCCACCCCCACCCCCAGTATCATAAACCAACTACAGAACACTGGGTGTGTCTTTTCTTTTTCGAGAT
GCTGGGATGGGATCT

Sequence Type genomic DNA
Unitrap ID UNI13754

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 77699156..77699488 333
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000017453 (Pipox) NM_008952 pipecolic acid oxidase Gene [Source:MGI (curated);Acc:Pipox-001]

 
Come back to gene ENSMUSG00000017453


For any suggestions or comments, please send an email to unitrap@crg.es