Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_147B1-3
Clone ID CMHD-GT_147B1-3
Vector Gep-SD5
Project cmhd

Sequence tag CMHD-GT_147B1-3
Sequence
GAAGAATAAGTAGTGACAGCATCTATCAAGAGCTAAGAAGAGACTCCCGCATTTCTCTGTGGTAGAGAACTGCTCACCAA
CCAAAGGAGGATCCTTTCTCAAGCAATGAACATTTCTTACAAGGATTCACAGATTAACACGTGACCAGTATTGATTTTTG
AAAGTAAATAAGATTTCCTTTTCTTCTTCTC
Sequence Type mRNA
Unitrap ID UNI13974

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 25170221..25170411 191
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037492 (Zmat4) NM_177086 zinc finger, matrin type 4 Gene [Source:MGI (curated);Acc:Zmat4-001]

 
Come back to gene ENSMUSG00000037492


For any suggestions or comments, please send an email to unitrap@crg.es