Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15086C6
Clone ID IST15086C6
Vector VICTR80
Project tigm

Sequence tag IST15086C6BBF1
Sequence
AGGGTCTCACTAAATTGTTCAAGCTGGCCTTATACTTGTAGCCAGGACTGGCCTTGAACATTCAATCTTTCTTCTTCAGC
TCCCAAGTAGCTAATATGACAGACCTGCACCATCAGATTCCAAATACATTGATGACCACAGCAGACTGTGGATCTGCTTT
AACACTTCTAATGGACTGCCACACCCAACTCTTTACTTCTTATATTATTTTTTCCATCAAATATGACTACTGTATACTAT
GTTTCAACTTTTAGACATTTTGCCTATGCAATTAAAATGTTACAAACTAGTAGGGATGGTTACAAAATAGTCAAACTCTT
GGTAATTAGTTAATTATAATAACATGTTTTCTAGGCTATTCAGATACTAAATAGCTAAGAATAAGTTAGTTTATATATGT
TAAAATTGACGGTTGATTTTCAAAACCCTCANAAATCCACAAGAAATGACACTTAAAATTATTTCGTTNTTAAAAGATCT
G
Sequence Type genomic DNA
Unitrap ID UNI14552

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 14019433..14019912 476
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000044117 (2900011O08Rik) NM_144518 RIKEN cDNA 2900011O08 gene Gene [Source:MGI Symbol;Acc:MGI:1914504]


Sequence tag IST15086C6HMF1
Sequence
AGGGTCTCACTAAATTGTTCAAGCTGGCCTTATACTTGTAGCCAGGACTGGCCTTGAACATTCAATCTTTCTTCTTCAGC
TCCCAAGTAGCTAATATGACAGACCTGCACCATCAGATTCCAAATACATTGATGACCACAGCAGACTGTGGATCTGCTTT
AACACTTCTAATGGACTGCCACACCCAACTCTTTACTTCTTATATTATTTTTTCCATCAAATATGACTACTGTATACTAT
GTTTCAACTTTTAGACATTTTGCCTATGCAATTAAAATGTTACAAACTAGTAGGGATGGTTACAAAATAGTCAAACTCTT
GGTAATTAGTTAATTATAATAACATGTTTTCTAGGCTATTCAGATACTAAATAGCTNAGAATAAGTTAGTTNATATATGT
NAAAATTGACGGTTGATTTTCNNANCCCTCANAAATCCNCAAGAAATGACACTTAAAANTATTTCN
Sequence Type genomic DNA
Unitrap ID UNI14552

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 14019433..14019897 447
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000044117 (2900011O08Rik) NM_144518 RIKEN cDNA 2900011O08 gene Gene [Source:MGI Symbol;Acc:MGI:1914504]

 
Come back to gene ENSMUSG00000044117


For any suggestions or comments, please send an email to unitrap@crg.es