Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10465C3
Clone ID IST10465C3
Vector VICTR76
Project tigm

Sequence tag IST10465C3HMR1
Sequence
ACTTTGTAGACCNGGCTGACCTTGAACTCAGAAATCTGCCTGCCTCTGCCTCCCA
Sequence Type genomic DNA
Unitrap ID UNI6726 UNI33976

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 56814652..56814706 53
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000002372 (Ranbp3) NM_027933 RAN binding protein 3 Gene [Source:MGI Symbol;Acc:MGI:1919060]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 26836001..26836055 53
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 94838590..94838644 53
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000063296 (Tmem117) NM_178789 transmembrane protein 117 Gene [Source:MGI Symbol;Acc:MGI:2444580]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 17076940..17076994 53
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 4755173..4755227 53
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 62112633..62112687 53
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 27857639..27857693 53
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 79439560..79439614 53
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 86663096..86663150 53
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 135566211..135566265 53
NO GENE  

 
Come back to gene ENSMUSG00000063296


For any suggestions or comments, please send an email to unitrap@crg.es