Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_133B6-3
Clone ID CMHD-GT_133B6-3
Vector Gep-SD5
Project cmhd

Sequence tag CMHD-GT_133B6-3
Sequence
GGAGAGTTAAGCATGCCAGTATGGCCGAGCCGAAAGACCGTCTACTGAGATCGAGACATGTGATCAAGCATCATGATGCT
CTGAAGATTCATTTGAACCTGCTTAATTACAAATCCAGTTTCTAATATGCTATACAATTTATGCACGCAGAAAGAAATAG
CAATGTACACATCACCTTCTTTATATCTTACTTTAAATGTTTTATGCATGTTTTCAAAAATTGGAAATATCCTAGATAGC
TGAGCAATAAATCTTCAATAAGTATTTTGATCAGAATAATAAATATAATTTTAAGAACAATAGA
Sequence Type mRNA
Unitrap ID UNI13977

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 121976842..121978612 221
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000060802 (B2m) NM_009735 beta-2 microglobulin Gene [Source:MGI (curated);Acc:B2m-001]

 
Come back to gene ENSMUSG00000060802


For any suggestions or comments, please send an email to unitrap@crg.es