Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_133A8-3
Clone ID CMHD-GT_133A8-3
Vector Gep-SD5
Project cmhd

Sequence tag CMHD-GT_133A8-3
Sequence
TCTAGGGACAGGAAGATGGTGGGTGATACGACTGGGGCCCAGGCCTTCGCCTCCACCGCCAAGTGCCTGAACATCAGCTC
CCTGTTCTTCACCATCCTCACGGCCATCGTCGTCATCGTTGTCTGTGCCATTAGATGATGTGAGATGTCTTGCAACATCT
CACAGTAGATAACAGATTCTGGGGCCTCCCAGGCTTGCTATGTGTTTCCTTGTCTATCGCTGCCCCAAACCCTAGACTTA
GTCCTGACCATTTGCCCCATACATATGCAAATGTGACACTCACAAATCTGTCCATGGTGGACTCAATAAAGTGCACGTGC
T
Sequence Type mRNA
Unitrap ID UNI13978

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 148155388..148155708 321
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025491 (Ifitm1) NM_026820 interferon induced transmembrane protein 1 Gene [Source:MGI (curated);Acc:Ifitm1-001]

 
Come back to gene ENSMUSG00000025491


For any suggestions or comments, please send an email to unitrap@crg.es