Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14947C3
Clone ID IST14947C3
Vector VICTR76
Project tigm

Sequence tag IST14947C3BBF1
Sequence
AGAGGACATCTTGCGTGAGTCCATCTCTGCTTCTACCACGTGAGTTCCAGGGATCAAACCCAGGCCACCAGGCTTGGCGG
CAGGTACTTTTTCCTGCTGAGCCAGCTTGCTGACCCTAATGGCCCCATACTTTTTGTTTGTTGTTTTCAGTTAGCTCTGT
GAAGGATTTGCTGGTATTCTTTTCTCAAGAAGCCCCACCCCCAACCCGCCGGGTTTACTGAGACAGGATCTGGATGTATA
ACCCAGGTTGGTATTGGACTTACTGTGTTTGGTTAGAGAAGACATCCTCTTCCCGATGCTTTCTGGATGCTGAGATTATA
GGAATTTGACACCTGGTTTAANATTTTATTGCTTTTACCACTGGAAACAGAACCCCAGTGCTTTGAACTCNNCNTTTGAC
TTTCTTTTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 34450846..34451253 400
 
EST/CDNA Est Name
  CJ059904.1


Sequence tag IST14947C3HMR1
Sequence
CTCTGAGTTTAAGTCNAGTGCGTCATGTGGGCACAAACTCGCTAAATAAATACTTTAAAAATCCGTGGGCCGGGCGGTGA
TGGTGCACGCCTTTAATCCCAGCACTCGGGAGGCAGAGGCAGGCGGATTTCTGAGTTCTAGGCCAGCCTGGTCTACAGAG
TGAGTTCCAGGACAGCCAGGGCTACACAGAGAAACCCTGTCTCNAAAAACAAAACAAAATAAAAATAAAAATCCGTGGAT
AGAACTGAANAGATGCTCTGTANGTTAAACCCACTTGCTGTTCTTGCAGAGGATGGGGTTTCNANCACACAGGCTTGGGG
GGGGGGNTN
Sequence Type genomic DNA
Unitrap ID UNI33980

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 34450524..34450849 314
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000050379 (Sept6) NM_019942 septin 6 Gene [Source:MGI (curated);Acc:Sept6-003]


Sequence tag IST14947C3HMF1
Sequence
AGAGGACATCTTGCGTGAGTCCATCTCTGCTTCTACCACGTGAGTTCCAGGGATCAAACCCAGGCCACCAGGCTTGGCGG
CAGGTACTTTTTCCTGCTGAGCCAGCTTGCTGACCCTAATGGCCCCATACTTTTTGTTTGTTGTTTTCAGTTAGCTCTGT
GAAGGATTTGCTGGTATTCTTTTCTCAANAANCCCCACCCCCNACCCGCCGGGTTTANTGNNACNNGNTCTGGATGTTTA
ACCNANGTTGGTNNTGGACTTANNGNGTTTGNTTNNANANNANNNCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000050379


For any suggestions or comments, please send an email to unitrap@crg.es