Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10588G11
Clone ID IST10588G11
Vector VICTR76
Project tigm

Sequence tag IST10588G11HMF1
Sequence
CTTCCATCTCTTCCTTTCTTCCTTTCTGTTGGAAGCCA
Sequence Type genomic DNA
Unitrap ID UNI32898

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 25371331..25371367 37
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036611 (Eepd1) NM_026189 endonuclease/exonuclease/phosphatase family domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:1914734]

 
Come back to gene ENSMUSG00000036611


For any suggestions or comments, please send an email to unitrap@crg.es