Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_180G11-3
Clone ID CMHD-GT_180G11-3
Vector Gen-SD5
Project cmhd

Sequence tag CMHD-GT_180G11-3
Sequence
TTAGCTTTGCCAGCATTGCAATCTCTGGTGACAATGTCAACTATAGTGACTTGACAATGAAAGCCAGCGACAAGTTTAAG
TTTGTCTTCCGAGAGAAGATCAGCAGAATCATTGATTATTTCACAATTCAAAACCCCAGCAATGTGGATCGATACTCCAA
ACTACTATTTCCTTTGATTTTTATGTTGGCCAATGTATTTTTACTGGGCATACTACATGTATTTTTGAGACGCCATTGAA
CTCTTGCATCACATAATGAGGTTAAGGTATTCTAGAACATGTGTGTGCACTTCAGCTTAGAAGCTACAAATGGGCTATGT
AACAATTATTCTAGGTGTGTAGAAGCCCTAGTGTGACCA
Sequence Type mRNA
Unitrap ID UNI13980

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 33452405..33452766 339
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020159 (Gabrp) NM_146017 gamma-aminobutyric acid (GABA-A) receptor, pi Gene [Source:MGI (curated);Acc:Gabrp-001]

 
Come back to gene ENSMUSG00000020159


For any suggestions or comments, please send an email to unitrap@crg.es