Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14737B3
Clone ID IST14737B3
Vector VICTR76
Project tigm

Sequence tag IST14737B3HMR1
Sequence
GCACGAACCAGCAGCCNCAGTTCAGTCCTCTCGGCAAGCAGACTCTGCAAGT
Sequence Type genomic DNA
Unitrap ID UNI32452

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 21141142..21141193 50
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000057193 (Slc44a2) NM_152808 solute carrier family 44, member 2 Gene [Source:MGI Symbol;Acc:MGI:1915932]


Sequence tag IST14737B3HMF1
Sequence
GTGCCTGGTGTCTGCCTGCATAGGGGGACTGGTCTGCAGCTGCTGAATCGTATGAGTGTTTGTTACAGGCCTGAACTGCT
GCCAAAGAAGATCAAGACTGCTCTAAAGAACTATTGCTGAACAGATCCACTTCCCCTATATCCTAATAACTTTTCTCTTC
CACTACCTCTGCTGGGCTAGAGGAAAAGTTAAACACTTATTAAAAGTAAATTGCAAAAATGTTTTGCTTACAGTCACTGT
TCAGTCAATGTAGGGGTCAGTGTGGGGCATACAGCTGGGTTAACG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 21140862..21141145 284
 
EST/CDNA Est Name
  CN693811.1 - CV306849.1 - CV306892.1


Sequence tag IST14737B3BBF1
Sequence
NTGCCTGGTGTCTGNCTGCATAGGGGGACTGGTCTGCAGCTGCTGAATCGTATGAGTGTTTGTTACAGGCCTGAACTGCT
GCCAAAGAAGATCAAGACTGCTCTAAAGAACTATTGCTGAACAGATCCACTTCCCCTATATCCTAATAACTTTTCTCTTC
CACTACCTCTGCTGGGCTAGAGGAAAAGTTAAACACTTATTAAAAGTAAATTGCAAAAATGTTTTGCTTACAGTCACTGT
TCAGTCAATGTAGGGGTCAGTGTGGGGCATACAGCTGGGTTAACATTATACAGTTGGATAGAGCTATATACACACACACT
TAAGTAATTTGTACATTTCTTTTTTAAAGATTTATTTATTATATATAAGTACACTGTANCTGTCTTCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 21140759..21141144 382
 
EST/CDNA Est Name
  CN693811.1 - CV306849.1 - CV306892.1

 
Come back to gene CN693811.1 - CV306849.1 - CV306892.1


For any suggestions or comments, please send an email to unitrap@crg.es