Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_180C7-3
Clone ID CMHD-GT_180C7-3
Vector Gen-SD5
Project cmhd

Sequence tag CMHD-GT_180C7-3
Sequence
CTCCAGCTCCTTCTTGCTCAACTTGCTGGCAGGAATCATCTCTGTGACCTTCCTGCTCCTACCACTGCAGGATGAGCTTG
GCAGCCAGCTGCCTCAAGTCCTGCACGTGTCCCTGGGACAGAAGCTGGTTGCGGCCTACGTCTTAGGCCTCCTCACCATG
GTGCTCCTCCGGACCTGAACTCTCAGCTGAACCCACCTCACCCACCCTCTCCTTCGCAGGCAGGGACCTAAAGGCAGCCA
CTGTGATGTTTGCACCTTGCTCCTCCTCCCTCGCTTCCGCCCATCCGTTGCTCCTCCTCCCTCGCTTCCGCCCATCCGTT
GCTCCTCCTC
Sequence Type mRNA
Unitrap ID UNI13981

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 138038099..138038522 182
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037221 (Mospd3) NM_030037 motile sperm domain containing 3 Gene [Source:MGI (curated);Acc:Mospd3-001]

 
Come back to gene ENSMUSG00000037221


For any suggestions or comments, please send an email to unitrap@crg.es