Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14176C2
Clone ID IST14176C2
Vector VICTR74
Project tigm

Sequence tag IST14176C2HMF1
Sequence
GTATCACCTATGCATACATGCTGTCTGTCTCTGCCCCACCTTCCTGAGATCCTGTGCAGGTGTGTGTGTN
Sequence Type genomic DNA
Unitrap ID UNI22491

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 69508542..69508610 69
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018752 (Tnfsf12) NM_001034097 tumor necrosis factor (ligand) superfamily, member 12 Gene [Source:MGI (curated);Acc:Tnfsf12-002]


Sequence tag IST14176C2BBF1
Sequence
GTATCACCTATGCATACATGCTGTCTGTCTCTGCCCCACCTTCCTGANATCCTGTGCAGGTGTGTGTGTGTGCGTGTGCG
TGTGCGTGTGCGTGTGCGTGTGCGTGTGTGTGTGTGTGANTNNANNGN
Sequence Type genomic DNA
Unitrap ID UNI22491

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 69508492..69508610 117
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018752 (Tnfsf12) NM_001034097 tumor necrosis factor (ligand) superfamily, member 12 Gene [Source:MGI (curated);Acc:Tnfsf12-002]

 
Come back to gene ENSMUSG00000018752


For any suggestions or comments, please send an email to unitrap@crg.es