Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10750F1
Clone ID IST10750F1
Vector VICTR76
Project tigm

Sequence tag IST10750F1HMR1
Sequence
CTTCATGAGACAAATTGTCATAGCAGGTTTCGTTTTGTTTCTTGTTTAATTGGCTGACGCACAGCACCACAAAGAGCAGT
CACAAGGTATCAAAGCCGGGCCAGCTCTGACACCCTGATCTCATGAGTAACAGCCTTGTGCTCCCCGATGGCCTAATCTG
CTCCAGGTGTTANATTTTGTAGCCTGACTAAAGATGAAACTAGGAGCATCGTCATGGGCTTCANCATTGATGTGGAAGGA
TGACTAATTTATTGCANTTGCTAATGANAANCNNANNCNGNTGTN
Sequence Type genomic DNA
Unitrap ID UNI12637

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 102950982..102951251 262
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000007379 (Dennd2c) NM_177857 DENN/MADD domain containing 2C Gene [Source:MGI Symbol;Acc:MGI:3036254]


Sequence tag IST10750F1HMF1
Sequence
ATACTAATAAATAAATCNTTAAAAAANGCATAATAAATGAAAAATATAACCAGTCTTCTTGGAACTCCTTTCCAGTAACT
NANACTGAANACTANGCTAGCTGCAAAGTTACAGTGATCCACCTCCCTCTGCCACCACCACCACCACCACTGCCTGGA

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000007379


For any suggestions or comments, please send an email to unitrap@crg.es