Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14418C2
Clone ID IST14418C2
Vector VICTR74
Project tigm

Sequence tag IST14418C2HMR1
Sequence
NAANAAAAAGGAGACGCTACTCCCAGCGACCCCGCCGCCGCCTCCGCTGCTCCCGAGGCCTCACCAAAATGGCCGCCGCC
GTCTCGGCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 134655596..134655683 86
NO GENE  


Sequence tag IST14418C2HMF1
Sequence
GCAACATCTGAAATACCTTGAGATTTGTAGTTCTCGCTTTTCTGGTAGCATCCTCTGGCTTCGTGGCTGTAGGTCATGGA
GACAGGCTTGATCCTCCTTTTAGCAAGGCAGGCTAGGGGAGCCTCCCTCTCTGCTCTTGGAATTGGCTTTGGGTTAGGAA
GCAGAGGAAGCAGGGCTTATTAGAGCTTCCTTTATCAGCTGTGCTGGTACCTGCTTATAAGTTCAGAATTTGGGAGGTCA
AGTCAGGAGGATCAAGCACAGGTCTATATAGTGAGACTCTATCTCAAAGCAAGCAAGCAAGCAAGCAAACAAACAAACAT
ACAAGGCCAAAATAAAAACGTCTAGATTGAAGCTGATCANAACGACTTANNATATTANACATGATTTTAGANNGGANAGA
NCCTCCTGGTCTTTCATCCTTCTCNGTCNCTNGGCTTTGACCCNGGCAGGTTCCAN
Sequence Type genomic DNA
Unitrap ID UNI17262

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 96482654..96483108 431
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038354 (Ankrd35) NM_001081139 ankyrin repeat domain 35 Gene [Source:MGI (curated);Acc:Ankrd35-001]

 
Come back to gene ENSMUSG00000038354


For any suggestions or comments, please send an email to unitrap@crg.es