Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14395H6
Clone ID IST14395H6
Vector VICTR74
Project tigm

Sequence tag IST14395H6HMF1
Sequence
GGGAGAGCTACATACCTCTGCTGACAGTTTGTTCTTCCTCTGGGTTCCAAGACGCCTGTAGTATTTGGCTTTAGGAAGAG
ACCCATGTGTGACTGTGCTTGTCCCTTGAGGCCCCTCGTTCCCTTGGCCAG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 130194827..130194956 130
NO GENE  


Sequence tag IST14395H6HMR1
Sequence
TCTGTAATGAGATCNNNNNCNTANNNNNNNGNGNNNGGNNNNNGNNACAGTGTACTTATGTACTTAATAATAAATAAATC
TTTGGACCTGANCAG
Sequence Type genomic DNA
Unitrap ID UNI8647

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 49051378..49051426 47
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038014 (BC010304) NP_001028440 family with sequence similarity 120, member A Gene [Source:MGI Symbol;Acc:MGI:2446163]


Sequence tag IST14395H6BBF1
Sequence
GGGAGAGCTACATACCTCTGCTGACAGTTTGTTCTTCCTCTGGGTTCCAAGACGCCTGTAGTATTTGGCTTTAGGAAGAG
ACCCATGTGTGACTGTGCTTGTCCCTTGAGGCCCCTCGTTCCCTTGGCCATTTATCACAGAGAAGGCATGGTATAGGGTG
AGGCTTANGCCTGGCTCCCTTGCAAGGGTGGCTGCATCAGANGCCAGGACAGGAGCTAGTTTGTTCCTCTGCTGTTATGG
GAAAGGACTTTATGAACCNCACCTTGAGCAAAAAGTCCACCTGGCCCCACGAANGCCCTCTAGATTTGGCAGAAAGACTC
CCAAGGACCTAGCTGGGGCTCTCACTTTCCTCTGATGAGGGGAGTTTGGATGGGGTANCTCAGAGGCCTCACACTCNNTT
GGCNNATGTGAANCCCAGATTCNTCTCCAGCNAAANTNTTCACTCACCCNCTGCCTAGATTNACTTCNANAACTTGGCTG
GGGANAAAGGCNANGNAAGCNACTACCTGGNCTGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000038014


For any suggestions or comments, please send an email to unitrap@crg.es