Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11934G4
Clone ID IST11934G4
Vector VICTR76
Project tigm

Sequence tag IST11934G4HMF1
Sequence
GTTAGGCTAAAAAGGGAAAGGGGAACCGATAATTTACTGTTA
Sequence Type genomic DNA
Unitrap ID UNI29460

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 22757322..22757362 41
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000051650 (B3gnt2) NM_016888 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 Gene [Source:MGI (curated);Acc:B3gnt2-002]


Sequence tag IST11934G4BBF1
Sequence
GTTAGGCTAAAAAGGGAAAGGGGAACCGATAATTTACTGTTGACTCTGCCCTATACTGTTGGTTCAAATGTGTGTGCTTG
GTTTTTTAAGGGTTATATTAGGAAACAAGATCCAAACATTGTTGCTTAACCTAAAAATGATGCTGGTTGGTCTAAAAGGC
TGGTCTAAAAGCTAATATTTGGTAATACNACCTGTTATAACACACAAATAGTGGTACATAAATTACCAAAACTCANAAAT
TATNATAGAGGTCTTTTGGTCTTCTGTAATTGCTCTGGGGTCAAAAATCATTANNANNNNTTGTCTGACATTTTTTANTG
ATTACGGANNNNNTCGTGAATTGAATGAGGCTCGCTTCATTTGANAGCTATAANTATTACCTAACANNNGANGTCNTCCN
GTANAGGAGANAGTGCNNCGCTCCAGCTCANCTNANCTTGCCCTCCCTANNTNTNNCTCTGGNTGTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000051650


For any suggestions or comments, please send an email to unitrap@crg.es