Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13335H11
Clone ID IST13335H11
Vector VICTR74
Project tigm

Sequence tag IST13335H11HMF1
Sequence
TCGGGAGGCAGAGGCAGGCGGATTTCTGAGTTCGAGGCCAGCCTGGTCTACAGAGTGAGTTCCAGGACAGCCAGGGCTAT
ACAGAGAAACCCTGTCTCGA
Sequence Type genomic DNA
Unitrap ID UNI22269 UNI33987 UNI33988 UNI33989 UNI33990

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 16654487..16654586 100
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 11102862..11102961 100
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 6172896..6172995 100
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 15888333..15888432 100
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 62891047..62891146 100
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 8619096..8619195 100
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 78925352..78925451 100
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 4625772..4625871 100
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 10720718..10720817 100
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 28822260..28822359 100
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 17810431..17810530 100
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 8566407..8566506 100
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 102457152..102457251 100
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028524 (Sgip1) NM_144906 SH3-domain GRB2-like (endophilin) interacting protein 1 Gene [Source:MGI (curated);Acc:Sgip1-006]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 34052539..34052638 100
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 122721384..122721483 100
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 3292569..3292668 100
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000068566 (Myadm) NP_001087233 myeloid-associated differentiation marker Gene [Source:MGI Symbol;Acc:MGI:1355332]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 23448448..23448547 100
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031481 (Tpte) NM_199257 transmembrane phosphatase with tensin homology Gene [Source:MGI Symbol;Acc:MGI:2446460]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 21336541..21336640 100
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000057191 (AB124611) NM_206536 Protein HIDE1 Precursor (Highly expressed in immature dendritic cell transcript 1 protein) [Source:UniProtKB/Swiss-Prot;Acc:Q75VT8]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 98782935..98783034 100
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031314 (Taf1) NM_001081008 TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor Gene [Source:MGI (curated);Acc:Taf1-001]


Sequence tag IST13335H11BBF1
Sequence
TCGGGAGGCANAGGCAGGCGGATTTCTGAGTTCNAGGCCANCCTGGTCTACAGAGTGAGTTCCNNGACANCCAGGGCTAT
ACANANAAACCCTGTCTCGAAAAAAACAAAACAAAAAA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000031314


For any suggestions or comments, please send an email to unitrap@crg.es