Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14701C5
Clone ID IST14701C5
Vector VICTR76
Project tigm

Sequence tag IST14701C5HMR1
Sequence
NATAACAAAGGTGCTTGCTTGTTTGACTTGCAAGTTTGAAAACATTTTCTTTTCTGTCTTGCTAGAGTAATGACAATTGT
AGTGGTTACACAGTTCTGATCCTGAAGTAATTTTCTATCCNGAATTTGCAGCATTGCTCCATTGTTTTATTGATGTTAGG
CTANTCANAGGTCTAAACCATCCTANTTTTTTACCTATTCTCCTCCCTCCCCTCTCCCATGTGCACACTTTAAAACNAGT
CTGTTTTCATCCATTTTCCTGGATCATTANTTGGCTTTTTAATTTTGATAACCTCTGCCCAAAACGTTTTCAAATTAACA
CTTGGTTTCTTTCTCCATTTCTTTTCTGACTTCTTTCTTAGGAACTTCCTATTCAGGTGTTGAGTTTGTTTNCNACACCT
CTTTTCTCACCTGTTGGTGANTANTGNGTTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 94265058..94265486 407
NO GENE  


Sequence tag IST14701C5BBF1
Sequence
TTGATAACCTCCATTCTGGGAGCGCCTGGATTGCTATAAGGCAAGAGATGAGAAAAACCAAGAAAGTGAAAGCTACTGTC
TAAATAACAGAAATCCAACACCAGCAGTCTGAAGAAAGGGACAGTAAAGTTACCCAAGACTACCTGTGCCCTAGTAACGG
GAGAAAGCTTTCACTGTCAGAAGAGGAAACCTTAAATTATCCAACGTTTTTAATTGTTACTTTAAAGAATTTGAAGTAGG
GGGCTAGAGAGATGGCTCTGTGGTTAAGAGCACTGACTGCTCTTCCAGAGGTCCTGAGTTCAATTCCCAGCAACCACATG
GTGGCTCACAATCATCTGTAATGGGATCAGATGCCATTTTCTGGTGTGTCTGAAGACAGCTATAGAACTCATATACAATA
AATAAATAANTAATTTTNANNNNGATGCAGAAAAGGAGTGTAATTCTCTTTAAAAGANAAAAAAAAN
Sequence Type genomic DNA
Unitrap ID UNI33003

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 94265486..94265951 452
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000063314 (AL732597.10)  

 
Come back to gene ENSMUSG00000063314


For any suggestions or comments, please send an email to unitrap@crg.es