Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_181H9-3
Clone ID CMHD-GT_181H9-3
Vector Gen-SD5
Project cmhd

Sequence tag CMHD-GT_181H9-3
Sequence
ACGATGAGCGCATGCTGGTGGAACCTGCCTGCGGTGCCGCCCTGGCCGCCATCTACTCGGGCATCCTGTGGAGGCTCCAG
GCTGAGGGCCGCCTGAGTTCTGCCCTAGCTTCCGTTGTGGTCATCGTGTGCGGTGGCAACAACATTAGTAGCCAACAGCT
TCAGGAGCTGAAAATCCAGCTGGGCTGCAGCTGAAGAATCTCAGGAACTCCCCCAGAGGTTCCTGGACACCTTGGTGGGT
CACTCAAGGGACCTCGGTTCCAGTGGTCCTGCCCTC
Sequence Type mRNA
Unitrap ID UNI13979

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 120908285..120908560 276
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029596 (Sdsl) NM_133902 serine dehydratase-like Gene [Source:MGI (curated);Acc:Sdsl-002]

 
Come back to gene ENSMUSG00000029596


For any suggestions or comments, please send an email to unitrap@crg.es