Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14885E8
Clone ID IST14885E8
Vector VICTR76
Project tigm

Sequence tag IST14885E8HMF1
Sequence
GAGACCACAGGGTATGAGTAGCCGTTCTCAGTCGCCACACACTGGTAGAGGCCCCCGACACCATCCTGCGGCAGCAGCAA
GAGGGAGCCATTGTAGACGGTAGCAGAGGCTTCTGAGATTTTGGCTCGGCCATGACTCCAGTGGTAAGAGGCCAGTGCTG
ACAGGTGGGGGCAGGGCAGCTCCAGGATGGAGTTGGGGACTGTCAGGACTTCTTTAACTGGAGAAGAGAAAAGAGGTGAC
ATGTTCAGTGGGGAGGGAGGAAGGAAGGTGGGAGAGCCNNCCTTNNNTCTGTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 88240958..88241249 282
 
EST/CDNA Est Name
  BF019645.1


Sequence tag IST14885E8HMR1
Sequence
TCTCCTATTGGGTAGACAGCCNGGACCNGCCCCTGGCGCTGGACCCTGAGCTGGCGGGCGTTCCCCGTGAGCGTGTGCAG
GTCCCGCTGACCAGGGTCGGAGGCGGAGCTTCCATGGCTGCCCAGCGGTCCTACTGGCCCCATTTTCTCATCGTTACCGT
CCTCCTGGCCN
Sequence Type genomic DNA
Unitrap ID UNI33995

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 88240792..88240961 166
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028064 (Sema4a) NM_013658 sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4A Gene [Source:MGI (curated);Acc:Sema4a-001]


Sequence tag IST14885E8BBF1
Sequence
GAGACCACAGGGTATGAGTAGCCGTTCTCAGTCGCCACACACTGGTAGAGGCCCCCGACACCATCCTGCGGCAGCAGCAA
GAGGGAGCCATTGTAGACGGTAGCAGAGGCTTCTGAGATTTTGGCTCGGCCATGACTCCAGTGGTAAGAGGCCAGTGCTG
ACAGGTGGGGGCAGGGCAGCTCCAGGATGGAGTTGGGGACTGTCAGGACTTCTTTAACTGGAGAAGAGAAAAGAGGTGAC
ATGTTCANTGGGGAGGGAGGAAGGANGGTGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 88240958..88241227 266
 
EST/CDNA Est Name
  BF019645.1

 
Come back to gene BF019645.1


For any suggestions or comments, please send an email to unitrap@crg.es