Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10034H11
Clone ID IST10034H11
Vector VICTR75
Project tigm

Sequence tag IST10034H11BBF1
Sequence
ACTTGGGAGGCTGAGCCAGAGGACTTCTGTGAGTTGAGGCCAGCCTGGTTTAGCCTGGACGACTTCCTTCCAGACCACCC
AGAGCTACATGGTAAGACTTCTGACCCAATAAAATAAAAGAATAAAAATACTCCCATATATTTACAATGGCTTATGTATT
TCTTTAGACACTTAAAAAAAAAAATTTTGTTTCA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 65251483..65251676 180
NO GENE  


Sequence tag IST10034H11HMR1
Sequence
ACCNNAGGCTCTTGAGTCTGAGGCCNGTCCAGCTACATAGAGACTCTGANACTAACCTGGACTAGCTTGATTCTGTTTCA
AACAAAACATTTTTTTTTTTTTNNNTN
Sequence Type genomic DNA
Unitrap ID UNI22153

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 96480806..96480902 93
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038354 (Ankrd35) NM_001081139 ankyrin repeat domain 35 Gene [Source:MGI (curated);Acc:Ankrd35-001]

 
Come back to gene ENSMUSG00000038354


For any suggestions or comments, please send an email to unitrap@crg.es