Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14683D10
Clone ID IST14683D10
Vector VICTR74
Project tigm

Sequence tag IST14683D10HMR1
Sequence
TTTTGACATGCCTTGGGTGTTGCGGGGAGACAGAAGTGAGGAGGGTGTCTGGACTGGTGGGTGCTGACTGCCTTGGNCCC
NGTGNTGTN
Sequence Type genomic DNA
Unitrap ID UNI23040

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 55027935..55028022 82
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000000958 (Slc7a7) NM_011405 solute carrier family 7 (cationic amino acid transporter, y+ system), member 7 Gene [Source:MGI Symbol;Acc:MGI:1337120]


Sequence tag IST14683D10HMF2
Sequence
AAAATGACCCCGGCTTGGCTTTTCCCCCNCAAAAGGGGAAAACATGCTANCCTTANGATGTAGCATACCTTATTTATCNN
ACAGCTGANCCCTCAACCTGTTATGACACAGGACAGGCNTGAATGAGGCANTTNGTTNNAACTTTTTTCTGCCTCCCCCT
GACCCNNAAAGTCTCTCCCNTCTGATTTCANTTTCAAATGTCCCTGCGCTGANATGCCTGTATNANGAANNANCCCTGAA
NCCAACTGATTCNCTANATCCTCTTTTTGCTNATTTGCTGTTCTTTCCCCTAAGGAGTCTNNNTGCTGGGCTGAANCTTT
NAAANCNCTCCNGCTNCNGATGCNCAGCCNCCNNCCTGCTCGGGAATAGCCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14683D10BBF1
Sequence
TTANAAACACTAATTTGCTTGGACAATGTTGTAAGGAAGATCTGTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 79776669..79776713 43
NO GENE  

 
Come back to gene ENSMUSG00000000958


For any suggestions or comments, please send an email to unitrap@crg.es