Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12144C8
Clone ID IST12144C8
Vector VICTR76
Project tigm

Sequence tag IST12144C8HMF1
Sequence
AGCTTACTGTGTACACTGTCAGGTAAAACAGTGCAGACAAGAGCTAGGTCACAGACCAAAGGAAAGGGGAGTATGCTGCA
GGGGTCACTCTTATGGAGAAGGGCCTGATTAGGGCAGTGAGAATGATTTTGTAATTTCACAGATTGTATTAATTATGCAT
GGACGTATATAAAACTAGATTCGTGGGTGTTTAATTTGGGCAGGTTAGCTTGAACCAGTGGGTAATGAATTCCCATTTTA
NGATCTGTGTTATGAGATATGTGCAATCCTTGGGTGACATATTTAANTGAGCCCACAAATATTAAACACATGACNTTATC
TGTAGCTGTGTGTGTCACATTGTANNCNTNAGTAGTTAACG
Sequence Type genomic DNA
Unitrap ID UNI31672

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 177687762..177688121 346
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000078862 (OTTMUSG00000016327) predicted gene, OTTMUSG00000016327 Gene [Source:MGI Symbol;Acc:MGI:3709298]

 
Come back to gene ENSMUSG00000078862


For any suggestions or comments, please send an email to unitrap@crg.es