Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11822G4
Clone ID IST11822G4
Vector VICTR76
Project tigm

Sequence tag IST11822G4HMF1
Sequence
CTCCGTAACCTTTGAGTTCCTTTNNCCAGCTTANNNNNNGTGTCAGGTGTCAGTTGTGTGGTCCTTCTGCCTGAACTGAC
TGCATATCTGAATTCTGAAGAAAGCCATTAGGTCATTATGGTCTCTCCCCACACACCGCAGTGTTATAAAATCCACAGAG
GAACAAAGTCTCAGTCCCTCTAGACCTTCTAAACACGGAGGATGAGAAGCCCTGCGCTCTCTACCCTCCTATCCTTGCTG
CTCACCGGAGCTTTGGCCTTGACCCTGGTTCGCGCAGGTGAGTGCGGGTCAGGAGGGAAACTGCCTCGGCCAAGGAGAGT
GAGGGCAGCACTGGAGAAGCCAAGAAGCCGCACAACCGAAATAGCCTCACCACTCTTCCCTCTCCTTTCTCCAATCTTCA
TCCTGAACCCCACGCCCTGCTCCCCTTCTGTCACCTACACCTCTACAAGTCCCNGN
Sequence Type genomic DNA
Unitrap ID UNI28339

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 37126198..37126650 437
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024459 (D130003B22Rik) NP_001108547 histocompatibility 2, M region locus 6, pseudogene Pseudogene [Source:MGI Symbol;Acc:MGI:95918]

 
Come back to gene ENSMUSG00000024459


For any suggestions or comments, please send an email to unitrap@crg.es