Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11172G3
Clone ID IST11172G3
Vector VICTR76
Project tigm

Sequence tag IST11172G3HMF1
Sequence
CTGAATATTGGAAGANACACGTGAAACAGTTACAGAGCACAGGAGGCAATGTTTTTTAAAAGGCCCCATACAAACACTTG
AAGGGCATTTTTACAGTTTTCCCTACGCAGCACTGGGGGTTCTGGTCAGGCACTGGGGTGTGGATTTTCCCTTTGTGGAG
CGTCATCGTCAGTGACACACACACCACGTGCCCCAGTAACCTGGGAGGCCTCCTGGA
Sequence Type genomic DNA
Unitrap ID UNI33996

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 110599920..110600135 214
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000014668 (Chfr) NM_172717 checkpoint with forkhead and ring finger domains Gene [Source:MGI Symbol;Acc:MGI:2444898]


Sequence tag IST11172G3BBF1
Sequence
CTGAATATTGGAAGANACACGTGAAACAGTTACAGAGCACAGGAGGCAATGTTTTTTAAAAGGCCCCATACAAACACTTG
AAGGGCATTTTTACAGTTTTCCCTACGCAGCACTGGGGGTTCTGGTCAGGCACTGGGGTGTGGATTTTCCCTTTGTGGAG
CGTCATCGTCAGTGACACACACACCACGTGCCCCANTAACCTGGGAGGCCTCCTGGCCNCACCANCCTTCTANTCNGTGT
AAGAGGATCANTANACTGANTTCTCCCTCCCTCCCACTGGACCGNTCTCCCTNCTGTGTGCTGANGCAGTGACAGTGCAN
GTTTGTACTTTTGTATCTTTTCTACCTTGTACCTTGACTATGGTNNAAATGGGAAGCTCATANGANAANTTGTCAGCTGT
GTCANACNCATTCTCCGGAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000014668


For any suggestions or comments, please send an email to unitrap@crg.es