Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11653E5
Clone ID IST11653E5
Vector VICTR76
Project tigm

Sequence tag IST11653E5HMF1
Sequence
ATAGAAAGGTTTTGGGAAAAAGGAAAACAAAAGAAATGGGAAGAATGTGAGGAAGGGAGAAGTGAGCCTAAGCAGACTGG
TACCACCGTAAGCTGGCTTGGCGTGAGACTCAGGTCATCCTGCACTANCCTCTCCGTTGTATACAGCTGCNTAACTAACA
AGGATGTTAGGCAAGGTGGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 103748084..103748262 175
NO GENE  


Sequence tag IST11653E5HMR1
Sequence
ACCCCTTTCTAATCCCTTAGTTTTGATGGCTTGGCACACTCCTGATTGCCTCAGTTC
Sequence Type genomic DNA
Unitrap ID UNI32032

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 103748018..103748073 56
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034187 (Nsf) NM_008740 N-ethylmaleimide sensitive fusion protein Gene [Source:MGI (curated);Acc:Nsf-001]

 
Come back to gene ENSMUSG00000034187


For any suggestions or comments, please send an email to unitrap@crg.es