Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14846E12
Clone ID IST14846E12
Vector VICTR76
Project tigm

Sequence tag IST14846E12HMF1
Sequence
CCCTCAGAAGCCCTTGGGTAATTTGTGACTGACNATTTTGCCTCTGCCAAACTTGCAAAGTCCAAGTTTGTGTGGTGTAT
TTTTTCTTAGTCTATAAGCCTCTTCACATAATTAAACCCTCGTGACTCACAGGATGGGTGACCACGACGCCTAATGGAAT
GATCAAGATCACGCAGAAGAAGTTGGATTTTTTTTTTTAAAAANTTNCTTATTTNCTTATTNNGTNNNTNCNNNGNNNCN
GNNTTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 108620132..108620352 211
 
EST/CDNA Est Name
  AA518167.1


Sequence tag IST14846E12HMR1
Sequence
AGGGCAGTGCNAAACTGACAGAATTTAAGGGTGTTCTGAGTTTTTATAGCAGTATTGTAATAATTGNANTGTTTTCTTCT
CAAAGTGTGCATGTGTGTGTTTTATGGCAATATTTAGGATAAAAACATGCACTTGTATGTAACAATATAAGATGATTGTG
ATTGGCCN
Sequence Type genomic DNA
Unitrap ID UNI400

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 108619969..108620135 161
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032846 (Zswim6) NP_663431 zinc finger, SWIM domain containing 6 Gene [Source:MGI Symbol;Acc:MGI:1914513]


Sequence tag IST14846E12BBF1
Sequence
CCCTCAGAAGCCCTTGGGTAATTTGTGACTGACCATTTTGCCTCTGCCAAACTTGCAAAGTCCAAGTTTGTGTGGTGTAT
TTTTTCTTAGTCTATAAGCCTCTTCACATAATTAAACCCTCGTGACTCACAGGATGGGTGACCACGACGCCTAATGGAAT
GATCAAGATCACGCAGAAGAAGTTGGATTTTTTTTTTTNAAA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 108620132..108620332 199
 
EST/CDNA Est Name
  AA518167.1

 
Come back to gene AA518167.1


For any suggestions or comments, please send an email to unitrap@crg.es