Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14488D3
Clone ID IST14488D3
Vector VICTR74
Project tigm

Sequence tag IST14488D3HMF1
Sequence
CTTGTAATCCAAGGTGACCTTGAATGCAGAAATCTGCCTGAGGTTAAAGGTGTGTTCCACAATTGCCCCAGCTCTACTCT
AATTCTCTTA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 3004844..3004932 83
NO GENE  


Sequence tag IST14488D3BBF1
Sequence
CTTGTAATCCAAGGTGACCTTGAATGCAGAAATCTGCCTGAGGTTAAAGGTGTGTTCCACAATTGCCCCAGCTCTACTCT
AATTCTCTTA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 3004844..3004932 83
NO GENE  


Sequence tag IST14488D3HMR1
Sequence
TCTTTTTCCTCATCGTTTTTTTACAGATCTCTTCCCACATGATGCCTCCTCCCCAGCCCAGTGTCTCTTCTCTCATCTGC
ATTCTCAGTCATTTAGAGGTTTTAGCAATTTGGGGGCTTTTCTTCTTTCTGCCTGTTTTTCCCCCTCAAATGAGGAAAGG
CTAACTCTAAATCTTGTCTGCCAGTGTGCAATGTGAGAAGGCCACTTTTAAAACCTGGATCATGCTGGCCN
Sequence Type genomic DNA
Unitrap ID UNI18613

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 40763310..40763539 230
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028413 (B4galt1) NM_022305 UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 1 Gene [Source:MGI (curated);Acc:B4galt1-001]

 
Come back to gene ENSMUSG00000028413


For any suggestions or comments, please send an email to unitrap@crg.es