Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XR0380
Clone ID XR0380
Vector pGT0lxf
Project sanger

Sequence tag XR0380
Sequence
TTTTTTCTCTTCTACTTGTACCAACGTGCTTCTTCTCTTATTCTCCTAGGCGCAAGTATAGAAAAGTTCAACTGGTCCGC
CTTGTGGGGATGATGCTTCTTATATTTGCCAGAAAAGATCAGTGTCAATACATCTGTGTAGACTTCATTGACAGTATCTG
ATAATTTATCCTGGATATACCTGTAGATATGTCAGTCGTGGTCGTGATCCCTGTATTTCTCTACCACTTTTTTAGCATTG
TCTATTCGCTCCTGGCCGCCCACGTGGAAGAGTTCGAACGAAGGAATCAGGATTATAAAGACATCTGTGCAAGAATGACT
TTTTCAGTCCCCAATCAGACTGTCCCGCAAGTGAACATCATGAAGCATGATGTTGTCATTTGGCTGGGAGACTTGAACTA
CAGACTTTGCATGCCTGATGCCAGTGAGGTGAAAAGTCTTATTAATAAAAATGAGCTTCATAAGCTGTTGAAATTTGACC
AG
Sequence Type mRNA
Unitrap ID UNI2210

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 45289267..45291587 137
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000001173 (Ocrl) NM_177215 oculocerebrorenal syndrome of Lowe Gene [Source:MGI (curated);Acc:Ocrl-001]

 
Come back to gene ENSMUSG00000001173


For any suggestions or comments, please send an email to unitrap@crg.es