Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_173G12-3
Clone ID CMHD-GT_173G12-3
Vector Gep-SD5
Project cmhd

Sequence tag CMHD-GT_173G12-3
Sequence
GCAATCGTCTTGCTCTCTTGAGGATTCGTCATCTATGCATCGACTGTAGCTGCACGACGACAACTACAGAAGGAGTTTCC
AGACAAGTTCTTCTGAACGAACTTTTGTAATTCTTAGCAAACACTTCTTTTCTTCAGATGGCACCTATGTAGACTCAAAG
TAAAATTCACAATGC
Sequence Type mRNA
Unitrap ID UNI13990

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 40217080..40217252 171
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028407 (2010003O02Rik) RIKEN cDNA 2010003O02 gene Gene [Source:MGI Symbol;Acc:MGI:1913684]

 
Come back to gene ENSMUSG00000028407


For any suggestions or comments, please send an email to unitrap@crg.es