Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14845B8
Clone ID IST14845B8
Vector VICTR76
Project tigm

Sequence tag IST14845B8HMR1
Sequence
GTGGCGGTCACAGTTGTTGTGGAAGCCTTAGCTGCTCCGCTGGATTGGTCC
Sequence Type genomic DNA
Unitrap ID UNI25300

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 154713859..154713908 50
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074656 (Eif2s2) NM_026030 eukaryotic translation initiation factor 2, subunit 2 (beta) Gene [Source:MGI (curated);Acc:Eif2s2-001]


Sequence tag IST14845B8BBF1
Sequence
TTACTANNTANCTNTGGCTGTCCTGGANCCCACTGTGTANACCAGGCTTGGCCTTGAACTCACANAGGCCCACCTGCCTC
TGCCTCCTGGGTACAGGGATCAAAGGCATGTGCAACTATACCCAGCAAATCTAGGTCCTCTAGAACACAGTATTCTTAGT
TGCTAAGCCATCTCTCCAGCCCCACCCCCTTTTTAAAGACAGAATCTTATGTANCTCANGATGGCCCTGAGCCCACTATG
TAGCCAAAGATGACCTTGAACTCCTAATCTTCCTCCTCTGCATCCCATCAGTTATCATTANAGGTGCACATGCTCTTTGG
TTGGTTTGCTTNNGNNACNNGNNCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 52705290..52705620 311
NO GENE  


Sequence tag IST14845B8HMF1
Sequence
TTACTATATAGCTCTGGCTGTCCTGGAGCCCACTGTGTAGACCAGGCTTGGCCTTGAACTCACAGAGGCCCACCTGCCTC
TGCCTCCTGGGTACAGGGATCAAAGGCATGTGCAACTATACCCAGCAAATCTAGGTCCTCTAGAACACAGTATTCTTAGT
TGCTAAGCCATCTCTCCAGCCCCACCCCCTTTTTAAAGACAGAATCTTATGTAGCTCAGGATGGCCCTGAGCCCACTATG
TAGCCAAAGATGACCTTGAACTCCTAATCTTCCTCCTCTGCATCCCATCAGTTATCATTANAGGTGCACATGCTCTTTGG
TTGGTTTGCTTTTGANACANGGTCTTACTGTGTAGCTNANTCANCCNGTGGAATGATANATAACTCTCCTGCCTCNGCTT
CCCCANTATGCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 52705210..52705620 391
 
EST/CDNA Est Name
  AW456833.1

 
Come back to gene AW456833.1


For any suggestions or comments, please send an email to unitrap@crg.es