Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12404E8
Clone ID IST12404E8
Vector VICTR76
Project tigm

Sequence tag IST12404E8HMF1
Sequence
TCTCAGACAGTGTGTTGCTTTGGCANTTCCCAGGTGGTACAGACTCTCACCTAAGCAGACTAAATTCCTAAGTTCCTTGG
AGTCCCGGGACCAAGATGGCGACCGCTGCTGCTGTGGCTTANGCCGCCTCCCCAGCCGGGTGGGCACCTGTCCTCCGGTC
CGGAAGGTGGCCGGNNGNCCCCGGNNCANNNANGGNGCNGN
Sequence Type genomic DNA
Unitrap ID UNI31065

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166438: 133871..134054 174
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 13974721..13974904 174
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 27620697..27620880 174
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 64020772..64020955 174
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 26128083..26128266 174
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 28188424..28188607 174
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022262 (Dnahc5) NM_133365 dynein, axonemal, heavy chain 5 Gene [Source:MGI Symbol;Acc:MGI:107718]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 7129435..7129618 174
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 22363478..22363661 174
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 23740674..23740857 174
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 82251789..82251972 174
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 25142427..25142610 174
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 38492202..38492385 174
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 28624324..28624507 174
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 18535639..18535822 174
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 62715413..62715596 174
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 13870836..13871019 174
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 14606281..14606464 174
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 26011584..26011767 174
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 18769856..18770039 174
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 40217279..40217462 174
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 31757569..31757752 174
NO GENE  


Sequence tag IST12404E8BBF1
Sequence
CTTTCTCANACNGTGTGTTGCTTTGGCAGTTCCCANGTGGTACANACTCTCACCTAAGCACACTAAATTCCTAANTTCCT
TGGANTCCCGGGACCAANATGGCNACCGCTGCTGCTGTGGCTTAGGCCGCCTCCCCANCCNGGTGNGCACCTGTCCTCCN
GTCCGGAAGGTGGCCGGCTGTCCCCGGCCCACACANGGTGCTGCCTCAACGCCNCNGTGCTTCTGCCTGTTCCANAANCT
GTCNNGTTCTCTGGCGCACCCTNTNACCTGTTNANACTAATTTCCTANGTTCNGCNGGTCTNNNACCAAA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000022262


For any suggestions or comments, please send an email to unitrap@crg.es