Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10873C3
Clone ID IST10873C3
Vector VICTR76
Project tigm

Sequence tag IST10873C3HMR1
Sequence
TTAGAACCGATTCTTCCNTAAGCGCAGTTGATACACGTCACCTCTGTGCGCTCCGGAAAGAGATCCTCCTCTGTATATGG
TATCAAACTCTCGGAGCTCTAAAATTCCGCTTTAAATCCTCACTTAAATGCAGCCTCCCCCCCCCCTTTTTTTTTNCNNC
CC
Sequence Type genomic DNA
Unitrap ID UNI1575

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 108420458..108420612 153
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000006673 (Qrich1) NP_001107591 glutamine-rich 1 Gene [Source:MGI Symbol;Acc:MGI:1916482]

 
Come back to gene ENSMUSG00000006673


For any suggestions or comments, please send an email to unitrap@crg.es