Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14779A12
Clone ID IST14779A12
Vector VICTR76
Project tigm

Sequence tag IST14779A12BBF1
Sequence
TCTGTTTTGTTGGTTTTTTTGAGACAGANTCTNACTTTGTANCCCTGGCTGGCCTANAATTCCAGGTGTAGACCAGGCTG
GCCTTGGACTCACAAATATCTCCTCACCTCTGCATTATTGTTTTGTTTTTGTTTATTTTTTCTTTTATTCTGTTTTTCTG
AGGCAATGTTTTTCTGTGTAGCCCTGGCTGTCCTAATTCTGTANACCANGCNNNCCTCAAACTCACAGANGTCCNTCTGC
CTNTGNNNTCCAAGANCTGGGATNAAANACACNTGTCANTGNNCTGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14779A12HMF2
Sequence
NTCNAANCNNCCGTAACANNATCTGACTCCCTCTTCTGGTGTGTCTGAAGACAGCTACAGTGTACTTAC
Sequence Type genomic DNA
Unitrap ID UNI26561 UNI31569 UNI33869 UNI34001

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166438: 158100..158158 55
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 4767052..4767110 55
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 6171275..6171333 55
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 23974693..23974751 55
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024114 (4931440B09Rik) NM_027644 RIKEN cDNA 4931440B09 gene Gene [Source:MGI Symbol;Acc:MGI:1918253]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 13919735..13919793 55
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 8056398..8056456 55
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 32890073..32890131 55
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 8775187..8775245 55
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 6389162..6389220 55
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 48880565..48880623 55
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 21710541..21710599 55
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 60673561..60673619 55
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000059901 (Adamts14) NM_001081127 a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 14 Gene [Source:MGI (curated);Acc:Adamts14-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 13874024..13874082 55
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 29993268..29993326 55
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 20385086..20385144 55
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 6626113..6626171 55
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 26659629..26659687 55
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 19909987..19910045 55
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027615 (Hps3) NM_080634 Hermansky-Pudlak syndrome 3 homolog (human) Gene [Source:MGI (curated);Acc:Hps3-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 7538617..7538675 55
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031162 (Gata1) NM_008089 GATA binding protein 1 Gene [Source:MGI (curated);Acc:Gata1-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 26732007..26732065 55
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 10877899..10877957 55
NO GENE  


Sequence tag IST14779A12HMR1
Sequence
NNAAAGCCNCTTCAAAAGCATCCAAACACTAAAAACCGGGACAAACGAGGTTTTGTTTTATTTTTCACATGAAGAAGCAG
CANGGAANAAAAATAAATAAATAAATAGTTGGTTGTGTGGGTTTGAAAAGCCTATGGGAAAATAATTAACTAGTGGTTGG
CACCCTCCTTTGAACAATGGCCCAGTCTCCANATTGACGCACACAGTTTGGGGTCCAGCTATTGAAGCAGTCACTAGGGG
TGGCTCTCANTACTCTCCACACTGTANCTCCTTGANANTGGAGTCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 165784141..165784423 267
 
EST/CDNA Est Name
  CK616793.1

 
Come back to gene CK616793.1


For any suggestions or comments, please send an email to unitrap@crg.es