Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14674E2
Clone ID IST14674E2
Vector VICTR74
Project tigm

Sequence tag IST14674E2BBF1
Sequence
CTGGTCAGCAAAGGGTCTTGGTCCTCAAGGTGGACTGTGTCCTGTAACTTGGCGGTAGGTACTGCTCAGCCAGCCCGGAC
CACAGTGGCAAGACAGCACCGGAGGCCGGGTCGCAAGCCTGGCTCAAGACGGGCACAGCGCCACGTCCTCCTGCAGAATG
TCCCACCCCAGCCCACTAGCCTCTCTGCGCGGAGGGCATCTTTTGCGGCTCTCTTCCCCACTGACAGGCCTAAAGCGGTG
AAACTGATGGTGCCGCAAGCTTCGGAGCCCTAAATCAGCCAGGGAACCTGAATAGGAACCCTGAGCCTCCCGAGTGGGGG
CGGATGCCCGCCGGGAGCACCTGANCNNCAGGCTGATACGGTCCTCGATACNCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 101545302..101545672 365
 
EST/CDNA Est Name
  AK011264.1 - AK006208.1 - AK011738.1


Sequence tag IST14674E2HMR1
Sequence
NNGAAGCTTCGGTTGTTTATCGTCCTACCAGGACGATGATGCTCCCCAGTCAGCAGTTTTTANAGAAAATTTGGCGGCCA
GAAACTTTAGTCTAAGGCCTGGACCAAGTTTATCCTACTGCCTATGGTGAACTCTTCAAGCTAAGAAAAGCAGCGTCTGG
TGTATGCGTANCAAGAGCCATACNGCTCANCTACNGCATAGTTTTTCCGTATTTAAATAGAGATAGGAGCCAAACATTTT
GTAATGCATGAAATCTAAATGTTAGTGTTCATACNGCTTATTGGGACACAGGTTTCTGGTACAGGGTCAGAGTTACATAG
TTAAAACAGGCTATNTGACTGCCNNNTNNNANNTTATTTGCTGTGTGGTTCTTTGCAGN
Sequence Type genomic DNA
Unitrap ID UNI5761

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 101544927..101545302 346
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000045273 (Cenph) NM_021886 centromere protein H Gene [Source:MGI Symbol;Acc:MGI:1349448]


Sequence tag IST14674E2HMF1
Sequence
CTGGTCAGCAAAGGGTCTTGGTCCTCAAGGTGGACTGTGTCCTGTAACTTGGCGGTAGGTACTGCTCAGCCAGCCCGGAC
CACAGTGGCAAGACAGCACCGGAGGCCGGGTCGCAAGCCNGC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 101545302..101545420 119
NO GENE  

 
Come back to gene ENSMUSG00000045273


For any suggestions or comments, please send an email to unitrap@crg.es