Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12308B1
Clone ID IST12308B1
Vector VICTR76
Project tigm

Sequence tag IST12308B1HMF1
Sequence
GAGGGAAGCTAAAAGGTTGGGCTGGAAGCACAGCCCCATAGTAGAACACTTGTCTGGCAGGGATGAGGCCCTGGGTTTGA
CTTAGTTTTTAATAGATAATTTTAAAACTCAGCACAGTGCTGACACCTGTATTCCCAACACTTACGAGGCAGAGGCAGGA
AGACCACTGCAAGTTCAAGTCTCTAAAAGGGAGAGTTAAGTTTTTAACTGGTAGCTGCCAACACTTACTATTTTGTATGT
GAAGACACTGCCCANAATGTTATGGTCTGCTGGCTCCCTTATTCTTTGTGATTCTGTTTGGGACTTGAGCTTCCTTTCCA
GCCATCTCCCTGTANNGCAGGTGTAATCTTCTTTCCTGGCATTATCTCACGCTCCCAATACATTTGAAGCTTGCCTGGCA
TACAGCTGGCTGGTGATAAAGCCCAGTGTGAGGCCCAAAATCTGTTGATGCCTTTAGCCNACTCTGCCACCTCCNANANA
TTTTTGCNATCCCTTTTATGATCNTTATTTATTGAAATGTGGATGCCNNNTGAANGNAATAACATAAAGTTATTCCN
Sequence Type genomic DNA
Unitrap ID UNI34002

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 164585373..164585928 528
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000017299 (Dnttip1) NM_133763 deoxynucleotidyltransferase, terminal, interacting protein 1 Gene [Source:MGI (curated);Acc:Dnttip1-001]

 
Come back to gene ENSMUSG00000017299


For any suggestions or comments, please send an email to unitrap@crg.es