Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12033H7
Clone ID IST12033H7
Vector VICTR76
Project tigm

Sequence tag IST12033H7HMF1
Sequence
CTACTACCAACAAACCCGGGGACTATAGAGTAGGACCCACGTCCAGACAGACTGACGAAAGCTTATGTCCTGAATTGCTA
ATGGTTTTATCCTGACGAGTGTCTGATGGGTTCTGGGGTGATGAAGAAAGGGGGCTTGTTTGTTACAGGACAGAAGGAAG
CTGCCAGGTGAAGGGCTGGAGAACTGGAGTCAGCTGGATCATTGGGAAAATGCTAGTGGCGTCATCAAAAGACGGAATTA
AAATTCAGGCTGGGAACTCTGATGGAGGGACCCCATAGCTGTTTCCTTCTGGGGCTGGACTGCTGTTCTTTTGGAAGGTG
CTGGANTATTCTGAGAAGACTCAAAACACTGTTGCTCACGTCCAGATGTGCCTTCNGTGAACTGGTGTGTTCGGGCATGG
CCTGGCCTGANANTGCCTTGAGGGTANAGGTGCTGTCCGACTTATCTGTGTGACAGTGCAGCAGTTGCTTNGCNTCTGNA
A
Sequence Type genomic DNA
Unitrap ID UNI10652

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 126143658..126144135 464
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041530 (Eif2c1) NM_153403 eukaryotic translation initiation factor 2C, 1 Gene [Source:MGI (curated);Acc:Eif2c1-001]


Sequence tag IST12033H7BBF1
Sequence
CTACTACCAACAAACCCGGGGACTATAGAGTAGGACCCACGTCCAGACAGACTGACGAAAGCTTATGTCCTGAATTGCTA
ATGGTTTTATCCTGACGAGTGTCTGATGGGTTCTGGGGTGATGAAGAAAGGGGGCTTGTTTGTTACAGGACAGAAGGAAG
CTGCCAGGTGAAGGGCTGGANAACTGGAGTCAGCTGGATCATTGGGAAAATGCTAGTGGCGTCATCAAAAGACGGAATTA
AAATTCAGGCTGGGAACTCTGATGGAGGGACCCCATAGCTGTTTCCTTCTGGGGCTGGACTGCTGTTCTTTTGGAAGGTG
CTGGANNATTCTGANAANACTCAAAACACTGTTGCTCACGTCCANATGTGCCNTCNNTGAACTGGTGTGTTCNGNCATGG
NCTGGCCNGANNGTGCCTTGANGGTANNNGTGCTGTCCNACTTATCTGTGTGACNGTGCAGCNGTTGCTTGNCGTCTGGN
AGGGCCTGACNCANAGANCNTGTTTATNAATTGACN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000041530


For any suggestions or comments, please send an email to unitrap@crg.es