Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14453H9
Clone ID IST14453H9
Vector VICTR74
Project tigm

Sequence tag IST14453H9HMR1
Sequence
GTAGACGCGATATGGGCCACACATGTGGAGCTCCAGAGTGGGGGTCAAAAATCAATCAGGCTTTCGAGAGGCGATGCGGT
TTGAACTGAGTTAAAGTGTGTGTAGAAATTTGTCAGGTGGATTCCAGTGAGGATAGTGATGTTCCTAAAAGCCCAAATGG
CCTATGCAAAAGTATTGGAGAGCCTGGCGTGCTGGCTGGCTCTGATCTGTTTGTAATCCCAGCCTTTGGGATGTAGAANC
ANCAAAAGTTCAAGGTCACCCTTAACACCGTTNANTTCNAGGTN
Sequence Type genomic DNA
Unitrap ID UNI19959

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 75162330..75162612 273
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018809 (Smyd4) NP_001096081 SET and MYND domain containing 4 Gene [Source:MGI (curated);Acc:Smyd4-001]

 
Come back to gene ENSMUSG00000018809


For any suggestions or comments, please send an email to unitrap@crg.es