Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11056G5
Clone ID IST11056G5
Vector VICTR76
Project tigm

Sequence tag IST11056G5BBF1
Sequence
GTTTTTGTTTTGTTTTTGATNAGATTGTTTTGTTTTGTTTTGCTTTGCTTTGAAATAAGAGTCTTACTATGTAGCCCTGG
GTGGTGACCTAGAACCAAGGTGTAGACTAAACTGTGGCTCGAAGCTTGAGAAATCCACCTGCCTCTGCCTCCAGAATTAG
GCATTACACCCAGCTAGAGAGGTGGGGCTTTTGTTGAGTCCTTTGTTTTGTTTGGGTTGACTTGAGTTGATTTCTCCTTT
TCTCTCCGGCTCTGTGAGGGGTGAACCTAGAGCTTGGTAGACAATTTTACCACTGACCACACACACACACACACACACAC
ACACACACACACACN

Sequence Type genomic DNA
Unitrap ID UNI13061

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 84837674..84838007 332
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000073633 (Fbxo36) NM_025386 F-box protein 36 Gene [Source:MGI (curated);Acc:Fbxo36-001]


Sequence tag IST11056G5HMF1
Sequence
GTTTTTGTTTTGTTTTTGATCNGATTGTTTTGTTTTGTTTTGCTTTGCTTTGAAATAAGAGTCTTACTATGTAGCCCTGG
GTGGTGACCTAGAACCAAGGTGTAGACTAAACTGTGGCTCGAAGCTTGAGAAATCCACCTGCCTCTGCCTCCAGAATTAG
GCATTACACCCAGCTAGAGAGGTGGGGCTTTTGTTGAGTCCTTTGTTTTGTTTGGGTTA

Sequence Type genomic DNA
Unitrap ID UNI13061

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 84837674..84837891 216
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000073633 (Fbxo36) NM_025386 F-box protein 36 Gene [Source:MGI (curated);Acc:Fbxo36-001]

 
Come back to gene ENSMUSG00000073633


For any suggestions or comments, please send an email to unitrap@crg.es