Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12491H3
Clone ID IST12491H3
Vector VICTR76
Project tigm

Sequence tag IST12491H3BBF1
Sequence
CTTTNATTATTGAAGGTATTTTCCGTGTCTGTGTGGAATGTTGAATTCATGTTTCTATCCATCTCCTTAGTATTTACCCT
GCATTTTCAATCTTAATCCAGGTTTAAATTCACTTAACATTTTCTTTCTTTCTTTCTTTTTTTTTTTTA
Sequence Type genomic DNA
Unitrap ID UNI13502

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 79944870..79945017 144
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000017550 (Atad5) NM_001029856 ATPase family, AAA domain containing 5 Gene [Source:MGI (curated);Acc:Atad5-001]


Sequence tag IST12491H3HMF1
Sequence
TTGACTAGGACCAGAAAACCACAGCTGCAGTTTCCGTGTGACTGAATTACACAACACTCCGCCCATCTTCTGCCTCTTAA
CTACACTCTGCCTCCTCTCCCCTGATGTTCCCTGAGCCTCGGAGGGGATGGGGGANNGNNAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 77681325..77681459 135
NO GENE  

 
Come back to gene ENSMUSG00000017550


For any suggestions or comments, please send an email to unitrap@crg.es