Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12413A4
Clone ID IST12413A4
Vector VICTR76
Project tigm

Sequence tag IST12413A4BBF1
Sequence
AAGGATACAGATCCTATGTCCTGAGACTTGTGTACTCCAGGGATGTGTATCCGTAAACTAGGATCTCCAGTGAGAGATGA
GCCCAGANTAAGAANAAACAGGCTGTGGCACANAGTCTATGGTGTGTGACAAATGGAAAGCTAAGTTGGACCANAGATCT
GT
Sequence Type genomic DNA
Unitrap ID UNI34006

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 34326913..34327064 144
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000070858 (Gm1673) NM_001033458 gene model 1673, (NCBI) Gene [Source:MGI Symbol;Acc:MGI:2686519]

 
Come back to gene ENSMUSG00000070858


For any suggestions or comments, please send an email to unitrap@crg.es