Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14915C9
Clone ID IST14915C9
Vector VICTR76
Project tigm

Sequence tag IST14915C9BBF1
Sequence
AAACCAGGGAGACACTCATACAAATAAAGTAAAAATAAATAAAAATCTTAAAGTGGGGGGGGAAGTCTGGAATGGGGGTG
CGTGCTTCAGTTCTGGGGAAACATAAATTCCAGGCAAATCTATAATAAATTTTCCTGGGTGGACGGGGAAAAAACACTGG
ATCTAGGAGGGAGAAAGAGTTTTAGGGGTTTAATTCATAGGTGCNCCCCTGANCACGCCGGANATACCCACACTGCNAAN
TTAGGAACCNGCGAGAATAACCAACCCGACGGCTAGAAAGGCGATGGTCCNCCGGCGGGCNGNTTCNCGTGACNTNANTT
CNNTTTNGNCTGANTNTGANTGGCNTTTGANANTGGCCNGNNTCNNTNCNNNNNCCCGGTGCTTTNCNGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14915C9HMR1
Sequence
CCCAGTCCNTGTGTCTCCNTCTGCCNGGAATAACTTCTTTGACACTTCTATCAGAATTTTTCTCCCTACTACCTTAAAGA
AAAAGACAAAGACCAGGGTCTTGTTGTGTAGCCCATAGTGAGCCAAGCTTGCCATCTTCAGCCTCTGTTCCCTAAATGTC
CGGATTGTAGGCATCCACTACATGCCTGGCCCACGCCGTCTTCCCTGCTCTCCTCCTCCTCTGGAACTTTGTTAANAGTC
TCTTTTCCAGTGCTCACTCTGTGGGGAGTGCACTCTGTTC
Sequence Type genomic DNA
Unitrap ID UNI7106

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 46412143..46412421 271
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000012296 (Tjap1) NM_028751 tight junction associated protein 1 Gene [Source:MGI Symbol;Acc:MGI:1921344]

 
Come back to gene ENSMUSG00000012296


For any suggestions or comments, please send an email to unitrap@crg.es