Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12750F11
Clone ID IST12750F11
Vector VICTR76
Project tigm

Sequence tag IST12750F11HMF1
Sequence
GAATAATGAATATGAATGTGATACAGGGTTGTGTATTAGGAATAAACTCTGAAAGCAGTAGGTTGAGATTTTTCATAGAT
GTCAACG
Sequence Type genomic DNA
Unitrap ID UNI4672

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 98298866..98298950 81
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074887 (A630089N07Rik) RIKEN cDNA A630089N07 gene Gene [Source:MGI Symbol;Acc:MGI:2444323]

 
Come back to gene ENSMUSG00000074887


For any suggestions or comments, please send an email to unitrap@crg.es