Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10491H9
Clone ID IST10491H9
Vector VICTR76
Project tigm

Sequence tag IST10491H9BBF1
Sequence
CCTGTTAAAGAAACATTAAGATATATTAAATACAAATCTGAAAAGCAGTTAAAAGAAACCATGATTTCTTAAAGTGGCAA
TCAACTATGTAACCATAGTAATTTTTGTACTTAACACACATCAAAAATTAAACAGATTCATGTTAAAATGGAAACAAATG
GATTTTGTANCTTTAATAAAGTTTCTCTGCTGTAGGTGCTCTGGAATGTACAGACAGTAGAACTCATGCATAACTAATTC
ATGACTCTAAAGACATTCTATGAGGAACTTCCTCAGCCTAAGGGGAAGCAAGCCCAGTAGAATATGGCCCTAATCACAAA
AGACTTGAATCTTTGAAACCCCAAGTGAAAGACACTAACTTAAAACTGANCATTTNNTTGAAACAAATCACCTTTTTCCA
TTTTGTNAGGGGATTCAGANTTCTGTTAANGTCATCTGTTAGTGTTAACNNAACTTTAAAAATAGCCTAAAGCCNANATA
GACCGGCTGANAGCCTATATTTCTAGNAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 66649891..66650396 482
 
EST/CDNA Est Name
  BB627678.1


Sequence tag IST10491H9HMR1
Sequence
GGGAGGGTGTTATGTGAGGTTTAAATGGAGCTGTACACGGGGTCACTTGTAAATTAGCCTTTCTATTTGTCATACACATT
TACTAGCCNGATTTTACCAAGGACTGTCC
Sequence Type genomic DNA
Unitrap ID UNI14486

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 66650419..66650526 106
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037876 (Jmjd1c) jumonji domain containing 1C Gene [Source:MGI Symbol;Acc:MGI:1918614]

 
Come back to gene ENSMUSG00000037876


For any suggestions or comments, please send an email to unitrap@crg.es